Sequence retrieval

Genome: Brucella suis 1330
Start position: 1214866
End position: 1214901
Length: 36

DNA sequence
>NC_017251, from 1214866 to 1214901 (36 bp); Brucella suis 1330 GCGGCAGCAGCAGGGGCAGCGCCACCGGCAGCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1214647-1215021	Sequence	BS1330_I1241 rplL 50S ribosomal protein L7/L12 (Protein is coded in complementary strand; from 1215021 to 1214647)