Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis CNCM I-2494
Start position: 496775
End position: 496801
Length: 27

DNA sequence
>NC_017215, from 496775 to 496801 (27 bp); Bifidobacterium animalis subsp. lactis CNCM I-2494 GGTCGATGTGGTCGACGTCGTCGATGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 496324-497025	Sequence	BALAC2494_00711 - Ribose-5-phosphate isomerase (Protein is coded in complementary strand; from 497025 to 496324)