Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis CNCM I-2494
Start position: 390030
End position: 390053
Length: 24

DNA sequence
>NC_017215, from 390030 to 390053 (24 bp); Bifidobacterium animalis subsp. lactis CNCM I-2494 TCGACCTCGACATCCACCTCGACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 387126-396458	Sequence	BALAC2494_00812 - Acyltransferase transferring groups other than amino-acyl groups