Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis CNCM I-2494
Start position: 300064
End position: 300099
Length: 36

DNA sequence
>NC_017215, from 300064 to 300099 (36 bp); Bifidobacterium animalis subsp. lactis CNCM I-2494 GAGGACATCGACGAGGATATCGACAACGACATCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 299267-300430	Sequence	BALAC2494_01918 - membrane associated protein