Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis CNCM I-2494
Start position: 299373
End position: 299396
Length: 24

DNA sequence
>NC_017215, from 299373 to 299396 (24 bp); Bifidobacterium animalis subsp. lactis CNCM I-2494 GAATCCGAATGCCAATCCGAACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 299267-300430	Sequence	BALAC2494_01918 - membrane associated protein