Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis CNCM I-2494
Start position: 216721
End position: 216744
Length: 24

DNA sequence
>NC_017215, from 216721 to 216744 (24 bp); Bifidobacterium animalis subsp. lactis CNCM I-2494 TCGCCGTCCCCGTCGCCTTCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 216529-217245	Sequence	BALAC2494_00936 - membrane associated protein (Protein is coded in complementary strand; from 217245 to 216529)