Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis CNCM I-2494
Start position: 198828
End position: 198863
Length: 36

DNA sequence
>NC_017215, from 198828 to 198863 (36 bp); Bifidobacterium animalis subsp. lactis CNCM I-2494 CGGAGGCAACGGAGGCAACGGAGGCAACGGAGGCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 197246-199114	Sequence	BALAC2494_00949 - Hydrolase acting on carbon-nitrogen bonds, other than peptide bonds, in linear amides (Protein is coded in complementary strand; from 199114 to 197246)