Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis CNCM I-2494
Start position: 1932741
End position: 1932776
Length: 36

DNA sequence
>NC_017215, from 1932741 to 1932776 (36 bp); Bifidobacterium animalis subsp. lactis CNCM I-2494 AGCATCCCCCCGAGCATGCCGCCGAGCTTCCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1930915-1934973	Sequence	BALAC2494_01115 - Conserved hypothetical membrane protein, MviN family