Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis CNCM I-2494
Start position: 1743485
End position: 1743514
Length: 30

DNA sequence
>NC_017215, from 1743485 to 1743514 (30 bp); Bifidobacterium animalis subsp. lactis CNCM I-2494 CAGTGCAGATCAGCGCAGCTCAGTGCAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1743505-1744167	Sequence	BALAC2494_01725 - orotate phosphoribosyltransferase (Protein is coded in complementary strand; from 1744167 to 1743505)