Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis CNCM I-2494
Start position: 151890
End position: 151925
Length: 36

DNA sequence
>NC_017215, from 151890 to 151925 (36 bp); Bifidobacterium animalis subsp. lactis CNCM I-2494 GCGGCTCGTCGGGCGGCGCGTCCGGCGGATCGTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 151748-151954	Sequence	BALAC2494_01979 - hypothetical protein (Protein is coded in complementary strand; from 151954 to 151748)
ORF. 151821-153086	Sequence	BALAC2494_00986 - Leucine-, isoleucine-, valine-, threonine-, and alanine-binding protein