Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis CNCM I-2494
Start position: 1333889
End position: 1333924
Length: 36

DNA sequence
>NC_017215, from 1333889 to 1333924 (36 bp); Bifidobacterium animalis subsp. lactis CNCM I-2494 CGATGTCATCGTCGGCGTCATCGTCGGCGTCATCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1332763-1335597	Sequence	BALAC2494_00095 - ABC transporter permease