Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis CNCM I-2494
Start position: 1328832
End position: 1328864
Length: 33

DNA sequence
>NC_017215, from 1328832 to 1328864 (33 bp); Bifidobacterium animalis subsp. lactis CNCM I-2494 GCATCACTTGGACATCACCTGGACATCACTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1327887-1328879	Sequence	BALAC2494_01694 - hypothetical protein
ORF... 1328858-1330498	Sequence	BALAC2494_00097 - OppA (Protein is coded in complementary strand; from 1330498 to 1328858)