Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis CNCM I-2494
Start position: 111138
End position: 111161
Length: 24

DNA sequence
>NC_017215, from 111138 to 111161 (24 bp); Bifidobacterium animalis subsp. lactis CNCM I-2494 ATGACGATGAAGCTGACGATGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 111123-111380	Sequence	BALAC2494_01024 - Integral membrane protein (Protein is coded in complementary strand; from 111380 to 111123)