Sequence retrieval

Genome: Bifidobacterium animalis subsp. lactis CNCM I-2494
Start position: 1092181
End position: 1092204
Length: 24

DNA sequence
>NC_017215, from 1092181 to 1092204 (24 bp); Bifidobacterium animalis subsp. lactis CNCM I-2494 ACCGCCACCGTCACCGACACCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1091941-1092561	Sequence	BALAC2494_00699 - hypothetical protein (Protein is coded in complementary strand; from 1092561 to 1091941)