Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis RO-NN-1
Start position: 1257647
End position: 1257682
Length: 36

DNA sequence
>NC_017195, from 1257647 to 1257682 (36 bp); Bacillus subtilis subsp. subtilis RO-NN-1 CCGTAACCTCCGCCATATCCTCCGCCATAACCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1257641-1257874	Sequence	I33_1360 - spore coat protein T (Protein is coded in complementary strand; from 1257874 to 1257641)