Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis RO-NN-1
Start position: 871035
End position: 871064
Length: 30

DNA sequence
>NC_017195, from 871035 to 871064 (30 bp); Bacillus subtilis subsp. subtilis RO-NN-1 TTTTTATTTTTTTGTTTTTCTATTTCTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 871026-871307	Sequence	I33_0922 - hypothetical protein (Protein is coded in complementary strand; from 871307 to 871026)