Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis RO-NN-1
Start position: 3697128
End position: 3697154
Length: 27

DNA sequence
>NC_017195, from 3697128 to 3697154 (27 bp); Bacillus subtilis subsp. subtilis RO-NN-1 CAGCAAGGACAACAAGGACAGCAGGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3696973-3697518	Sequence	I33_3944 gerQ spore coat and germination protein GerQ