Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis RO-NN-1
Start position: 1666639
End position: 1666665
Length: 27

DNA sequence
>NC_017195, from 1666639 to 1666665 (27 bp); Bacillus subtilis subsp. subtilis RO-NN-1 TCAAAATACTCAAAACACTCAAAATGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1666611-1666931	Sequence	I33_1806 fliE flagellar hook-basal body complex protein