Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis RO-NN-1
Start position: 3372464
End position: 3372488
Length: 25

DNA sequence
>NC_017195, from 3372464 to 3372488 (25 bp); Bacillus subtilis subsp. subtilis RO-NN-1 TTTTTTGTTTTTTTAATTTTTTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3371692-3373149	Sequence	I33_3604 - hypothetical protein (Protein is coded in complementary strand; from 3373149 to 3371692)