Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis RO-NN-1
Start position: 2950127
End position: 2950150
Length: 24

DNA sequence
>NC_017195, from 2950127 to 2950150 (24 bp); Bacillus subtilis subsp. subtilis RO-NN-1 TCATCTTCATCCTCTTCTTCATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2950025-2950459	Sequence	I33_3149 ytxO spore coat protein YtxO (Protein is coded in complementary strand; from 2950459 to 2950025)