Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis RO-NN-1
Start position: 2671812
End position: 2671835
Length: 24

DNA sequence
>NC_017195, from 2671812 to 2671835 (24 bp); Bacillus subtilis subsp. subtilis RO-NN-1 CTCTTCCTCTTGTTCTTCCTCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2671420-2673147	Sequence	I33_2861 spoVID stage VI sporulation protein D (Protein is coded in complementary strand; from 2673147 to 2671420)