Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis RO-NN-1
Start position: 1899617
End position: 1899640
Length: 24

DNA sequence
>NC_017195, from 1899617 to 1899640 (24 bp); Bacillus subtilis subsp. subtilis RO-NN-1 TTAATAGATCAATAGATTAATGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1899634-1900251	Sequence	I33_1997 lexA LexA repressor (Protein is coded in complementary strand; from 1900251 to 1899634)