Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis RO-NN-1
Start position: 1840134
End position: 1840157
Length: 24

DNA sequence
>NC_017195, from 1840134 to 1840157 (24 bp); Bacillus subtilis subsp. subtilis RO-NN-1 CCAAAACCAAATCCATAACCAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1839999-1840280	Sequence	I33_1922 - sulfur globule protein CV1 (Protein is coded in complementary strand; from 1840280 to 1839999)