Sequence retrieval

Genome: Bacillus subtilis subsp. subtilis RO-NN-1
Start position: 1050976
End position: 1050999
Length: 24

DNA sequence
>NC_017195, from 1050976 to 1050999 (24 bp); Bacillus subtilis subsp. subtilis RO-NN-1 CTTTTTTTCTATTTTTCTTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1050707-1051225	Sequence	I33_1127 - hypothetical protein (Protein is coded in complementary strand; from 1051225 to 1050707)