Sequence retrieval

Genome: Clostridium difficile BI1
Start position: 515701
End position: 515730
Length: 30

DNA sequence
>NC_017179, from 515701 to 515730 (30 bp); Clostridium difficile BI1 TACTTATATTTAATTTTATTTACTGATAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 515542-515799	Sequence	CDBI1_02230 - hypothetical protein (Protein is coded in complementary strand; from 515799 to 515542)