Sequence retrieval

Genome: Clostridium difficile BI1
Start position: 3924394
End position: 3924420
Length: 27

DNA sequence
>NC_017179, from 3924394 to 3924420 (27 bp); Clostridium difficile BI1 TCTTCATATTCTTCATATTCTTCATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3923545-3924816	Sequence	CDBI1_17235 - hypothetical protein (Protein is coded in complementary strand; from 3924816 to 3923545)