Sequence retrieval

Genome: Clostridium difficile BI1
Start position: 3806316
End position: 3806348
Length: 33

DNA sequence
>NC_017179, from 3806316 to 3806348 (33 bp); Clostridium difficile BI1 TAATTTTTTTATTATTTCTTTAAAATTTTTATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3806164-3807642	Sequence	CDBI1_16620 - sirohydrochlorin cobaltochelatase (Protein is coded in complementary strand; from 3807642 to 3806164)