Sequence retrieval

Genome: Clostridium difficile BI1
Start position: 3738165
End position: 3738194
Length: 30

DNA sequence
>NC_017179, from 3738165 to 3738194 (30 bp); Clostridium difficile BI1 TTTATTCATTCCTATTCATTCCTATTCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3738177-3738761	Sequence	CDBI1_16370 - ATP-dependent Clp protease proteolytic subunit (Protein is coded in complementary strand; from 3738761 to 3738177)