Sequence retrieval

Genome: Clostridium difficile BI1
Start position: 3673546
End position: 3673569
Length: 24

DNA sequence
>NC_017179, from 3673546 to 3673569 (24 bp); Clostridium difficile BI1 TACTGCTACTGGCACTGCCACTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3673061-3673852	Sequence	CDBI1_16065 - PTS system transporter subunit IIC (Protein is coded in complementary strand; from 3673852 to 3673061)