Sequence retrieval

Genome: Clostridium difficile BI1
Start position: 3631903
End position: 3631938
Length: 36

DNA sequence
>NC_017179, from 3631903 to 3631938 (36 bp); Clostridium difficile BI1 GCTGCTTCTTCTACTGTTTCTTCTACTACTTCTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3630325-3632205	Sequence	CDBI1_15890 - proline reductase subunit proprotein (Protein is coded in complementary strand; from 3632205 to 3630325)