Sequence retrieval

Genome: Clostridium difficile BI1
Start position: 3456574
End position: 3456627
Length: 54

DNA sequence
>NC_017179, from 3456574 to 3456627 (54 bp); Clostridium difficile BI1 TTCTTATTTAATACAAATTTCTTATTTAACATAGATTTCTTGTTTAATATAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3456618-3458045	Sequence	CDBI1_15120 - 6-phospho-beta-glucosidase (Protein is coded in complementary strand; from 3458045 to 3456618)