Sequence retrieval

Genome: Clostridium difficile BI1
Start position: 3384830
End position: 3384853
Length: 24

DNA sequence
>NC_017179, from 3384830 to 3384853 (24 bp); Clostridium difficile BI1 TTATAATTAAAATTACAAATATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3384256-3384873	Sequence	CDBI1_14840 - hypothetical protein (Protein is coded in complementary strand; from 3384873 to 3384256)