Sequence retrieval

Genome: Clostridium difficile BI1
Start position: 3306141
End position: 3306165
Length: 25

DNA sequence
>NC_017179, from 3306141 to 3306165 (25 bp); Clostridium difficile BI1 TTCTTTTGTTTTCATTTGTTTTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 3305689-3306156	Sequence	CDBI1_14515 - hypothetical protein (Protein is coded in complementary strand; from 3306156 to 3305689)