Sequence retrieval

Genome: Clostridium difficile BI1
Start position: 3082358
End position: 3082381
Length: 24

DNA sequence
>NC_017179, from 3082358 to 3082381 (24 bp); Clostridium difficile BI1 TTTATCTTCATCTTTATCTGTATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3082047-3083882	Sequence	CDBI1_13595 - cell surface protein (Protein is coded in complementary strand; from 3083882 to 3082047)