Sequence retrieval

Genome: Clostridium difficile BI1
Start position: 2899447
End position: 2899471
Length: 25

DNA sequence
>NC_017179, from 2899447 to 2899471 (25 bp); Clostridium difficile BI1 TTTTTTATTTCTTTTTTTGTATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2898928-2899602	Sequence	CDBI1_12885 - hypothetical protein (Protein is coded in complementary strand; from 2899602 to 2898928)