Sequence retrieval

Genome: Clostridium difficile BI1
Start position: 2873590
End position: 2873613
Length: 24

DNA sequence
>NC_017179, from 2873590 to 2873613 (24 bp); Clostridium difficile BI1 TATTTTTATTTGTATCTTGATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2873403-2875343	Sequence	CDBI1_12765 - hypothetical protein (Protein is coded in complementary strand; from 2875343 to 2873403)