Sequence retrieval

Genome: Clostridium difficile BI1
Start position: 2779598
End position: 2779627
Length: 30

DNA sequence
>NC_017179, from 2779598 to 2779627 (30 bp); Clostridium difficile BI1 ATTCTATTTTCTTCTAATTTATTCTTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2778638-2780944	Sequence	CDBI1_12365 - cellulose synthase catalytic subunit (Protein is coded in complementary strand; from 2780944 to 2778638)