Sequence retrieval

Genome: Clostridium difficile BI1
Start position: 2720693
End position: 2720722
Length: 30

DNA sequence
>NC_017179, from 2720693 to 2720722 (30 bp); Clostridium difficile BI1 TTTATTGTATTTTCTTTTAATTTATTGTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2720150-2722033	Sequence	CDBI1_12125 - selenocysteine-specific elongation factor (Protein is coded in complementary strand; from 2722033 to 2720150)