Sequence retrieval

Genome: Clostridium difficile BI1
Start position: 2693966
End position: 2693989
Length: 24

DNA sequence
>NC_017179, from 2693966 to 2693989 (24 bp); Clostridium difficile BI1 TTATTTTTATTATTCTTTTTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2693123-2694142	Sequence	CDBI1_12005 - stage II sporulation protein P (Protein is coded in complementary strand; from 2694142 to 2693123)