Sequence retrieval

Genome: Clostridium difficile BI1
Start position: 2606824
End position: 2606859
Length: 36

DNA sequence
>NC_017179, from 2606824 to 2606859 (36 bp); Clostridium difficile BI1 TTCTTATTGTTACTCTTATTTTTATTATTATTGTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2606386-2607054	Sequence	CDBI1_11610 - hypothetical protein (Protein is coded in complementary strand; from 2607054 to 2606386)