Sequence retrieval

Genome: Clostridium difficile BI1
Start position: 2425297
End position: 2425320
Length: 24

DNA sequence
>NC_017179, from 2425297 to 2425320 (24 bp); Clostridium difficile BI1 AAATATATAAATATAGAAATAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2423356-2425374	Sequence	CDBI1_10790 - hypothetical protein (Protein is coded in complementary strand; from 2425374 to 2423356)