Sequence retrieval

Genome: Clostridium difficile BI1
Start position: 2404317
End position: 2404340
Length: 24

DNA sequence
>NC_017179, from 2404317 to 2404340 (24 bp); Clostridium difficile BI1 TATATTTAGATTTAAATTTACATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2403572-2404354	Sequence	CDBI1_10705 - esterase (Protein is coded in complementary strand; from 2404354 to 2403572)