Sequence retrieval

Genome: Clostridium difficile BI1
Start position: 2278902
End position: 2278937
Length: 36

DNA sequence
>NC_017179, from 2278902 to 2278937 (36 bp); Clostridium difficile BI1 TAATTTTCTCATTTATTTTCTCCTAAATTTTTTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2277832-2278914	Sequence	CDBI1_10170 - ABC transporter permease (Protein is coded in complementary strand; from 2278914 to 2277832)