Sequence retrieval

Genome: Clostridium difficile BI1
Start position: 2239585
End position: 2239608
Length: 24

DNA sequence
>NC_017179, from 2239585 to 2239608 (24 bp); Clostridium difficile BI1 TTATCTATATCTTTTTCTTTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2239450-2240244	Sequence	CDBI1_10025 - FAD-binding subunit of xanthine dehydrogenase dehydrogenase (Protein is coded in complementary strand; from 2240244 to 2239450)