Sequence retrieval

Genome: Clostridium difficile BI1
Start position: 1561740
End position: 1561763
Length: 24

DNA sequence
>NC_017179, from 1561740 to 1561763 (24 bp); Clostridium difficile BI1 ATTTTTTTATTATTTTATTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1561076-1562167	Sequence	CDBI1_06805 - hypothetical protein (Protein is coded in complementary strand; from 1562167 to 1561076)