Sequence retrieval

Genome: Bacillus megaterium WSH-002
Start position: 4903447
End position: 4903470
Length: 24

DNA sequence
>NC_017138, from 4903447 to 4903470 (24 bp); Bacillus megaterium WSH-002 TTTCCTTTTTCTTTCCCTGTTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4903135-4903794	Sequence	BMWSH_5120 cysE Serine acetyltransferase (Protein is coded in complementary strand; from 4903794 to 4903135)