Sequence retrieval

Genome: Bacillus megaterium WSH-002
Start position: 4644696
End position: 4644722
Length: 27

DNA sequence
>NC_017138, from 4644696 to 4644722 (27 bp); Bacillus megaterium WSH-002 TGTATCAGGTGTATCCGGTGTTTCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4643008-4646181	Sequence	BMWSH_4878 yueB Bacteriophage SPP1 adsorption protein yueB (Protein is coded in complementary strand; from 4646181 to 4643008)