Sequence retrieval

Genome: Bacillus megaterium WSH-002
Start position: 4528336
End position: 4528359
Length: 24

DNA sequence
>NC_017138, from 4528336 to 4528359 (24 bp); Bacillus megaterium WSH-002 TGCTGTTGTTGTTGCTGTTGCTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4528305-4529027	Sequence	BMWSH_4768 yocH lytic transglycosylase (Protein is coded in complementary strand; from 4529027 to 4528305)