Sequence retrieval

Genome: Bacillus megaterium WSH-002
Start position: 3962034
End position: 3962057
Length: 24

DNA sequence
>NC_017138, from 3962034 to 3962057 (24 bp); Bacillus megaterium WSH-002 TCTTGCTTTTGCTCTTCCTTTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3960334-3962265	Sequence	BMWSH_4216 - hypothetical protein (Protein is coded in complementary strand; from 3962265 to 3960334)