Sequence retrieval

Genome: Bacillus megaterium WSH-002
Start position: 3680156
End position: 3680191
Length: 36

DNA sequence
>NC_017138, from 3680156 to 3680191 (36 bp); Bacillus megaterium WSH-002 GCTAAACCAACGGCAACACCAACGGCAACACCAACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3678353-3680419	Sequence	BMWSH_3929 ptsG Glucose-specific phosphotransferase enzyme IIA component (Protein is coded in complementary strand; from 3680419 to 3678353)